DNA stands for deoxyribonucleic acid and is one of the two types of nucleic acid found in our cells. The name describes what the molecule is. DNA is beautifully intricate and works in complicated mechanisms to control the cell. As a teacher, I am a strong believer that you can teach anyone, anything. The younger the student, the more likely they are to retain it. So, let us take a look at how you would explain DNA to a six-year-old. We are all made of trillions of cells. There are around 2. So tiny that we cannot see them. If every cell in your hand was the size of a grain of sand, your hand would be the size of a school bus! Each cell has its own job, just like humans do. Some cells help us detect light and see, other cells help us touch, some cells help us hear, other cells carry oxygen around, other cells help us digest food by secreting enzymes. There are over 200 cell types in the body - that is 200 different jobs! But how does each cell know what job to do? Well how do we humans know what job to do? Our cells are also told what to do, but not by a person or a computer! Our cells are told what to do by a very special molecule called DNA. DNA is a record of instructions telling the cell what its job is going to be. A good analogy for DNA as a whole is a set of blueprints for the cell, or computer code telling a PC what to do. It is written in a special alphabet that is only four letters long! Unlike a book or computer screen, DNA isn't flat and boring - it is a beautiful curved ladder. We call this shape a double helix. The letters of the DNA alphabet called bases make up the rungs, special sugars and other atoms make up the handrail. The rungs are very special. Each one has a name, but they prefer to be called by their initials: A, T, C and G They don't like to be by themselves so they always pair up with a friend. A and T fit together, C and G fit together. You cannot force a puzzle piece into the wrong place! Think of all the words you can spell. I bet there are loads. But each word is made using the same selection of letters. Yes, sometimes we leave letters out, sometimes we repeat letters, but we always have the same selection of letters. Depending on how we arrange the letters of the alphabet we can make new words. The same is true in the four letter alphabet of DNA. If you look at a length of DNA, you can read out the letters all in a row: ATGCGTGGTCAGTCGATATATGGCCCC These letters make up words that are always three letters long. These are called codons. ATG CGT GGT CAG TCG ATA TAT GGC CCC These words make up sentences that the cell understands. These sentences are called genes. These proteins control everything in a cell. In this way, DNA is like the boss of a company, and not the brain of the cell. It issues instructions, but doesn't do very much of the actual work : These proteins help each cell do its job. Each gene makes one , and only one protein. How can four letters make something as complicated as a human body? Let us take a trip back to my favourite childhood toy—Lego. Give a child 80 pieces of one colour and ask them to build a tower. No matter how they try, they can only make one possible combination of colours. Now give a child a box of Lego with 20 lots of 4 different colours and ask them to make a tower. The size is still the same, but the combination and order of colours is different each time they build. The possibilities are endless... Remember it is the sequence of letters order of the colours in this analogy that stores the information. Each set of 3 letters is a word. With four different letters, there are 64 possible three-letter-words. Imagine how many combinations of these words there are in a sentence just 100 letters long! I hope this has shown you that the basics of DNA are simple and straightforward. Whenever you are trying to convey complex ideas to young children, analogies are your friend. What is the structure of DNA? Find the answers here! Ok it is a little UK-centric but shows how DNA is of importance to all aspects of Biology. This was very interesting! I have an assignment about cells and I have to write a script that I will probably need to read and use , that explains an animal cell, a plant cell, and a simple bacterial cell, to a 3rd grader. This article really helps me to explain the DNA that is in these cells. Thank you for taking your time to write this article to help me and many others about this topic! Maybe this is lost on me because I work for myself, but this paints the picture of a chain of people telling other people what to do and everyone following blindly. Something to think about when discussing this concept with children! Humans have free will... I'm a scientist in America who has to regularly communicate my research to a general audience, and today I faced a new challenge in trying to explain DNA to a group of 4-year-olds. This article provided me with some good talking points and I think that they learned some good stuff about their DNA. Just to correct a small typo from one of the author comments above, the last letter in the OPPOSITE DNA strand should be a T, not an A. So, for the strand reading AAACTGCCGCGGTTATTATATTCGCGA the complimentary strand would read TTTGACGGCGCCAATAATATAAGCGCT. For example, a typical DNA strand could read AAACTGCCGCGGTTATTATATTCGCGA. The strand does not pair linearly. The OPPOSITE DNA stand remember DNA is a double helix with two strands wrapped around each other would read: TTTGACGGCGCCAATAATATAAGCGCA. These strands are read in groups of three to form words which are then made into proteins by the cell's construction workbench-the ribosome. Take a closer look at the last diagram above to clear this up. Although I still have a question. If A is paired with T and C is paired with G jigsaw combination. I really enjoyed writing a hub knowing that someone was looking for that answer - it was lots of fun! Let me know if there are any other topics you want covering. I am so pleased my hub was helpful to your class! Don't forget to check out the links because they can really help understanding - certainly the animation does. Both of these have made my day! This really answered my question thoroughly! This came up when I was studying the ocean with my students. We found out that every living organism in the ocean had its own unique DNA but that they can be grouped by their similarities. One inquisitive student wanted to know more about DNA! I came equipped with a print-out of your article today and shared with the class. Lo and behold, they were fascinated! When we wrap up this study we have decided to move on to a study of DNA. I was even planned a trip to CalTech Poly where we will look at DNA using microscopes! I never thought I would get this kind of inspiration from hubpages and I thank you for your willingness to share your knowledge! If this weren't true, the organism would swiftly die. Variation, both inter and intra species, is caused by quite different processes - namely crossing over and random assortment of chromsomes during meiosis and then recombination during fertilisation. You can take the book out of the library and even unravel it by taking out the pages. You follow the cake recipes inside the book but when ever you make the cake it never turns out quite the same way twice. When you've finished you have to return the recipe book to the library because that is where its stored. Made sense to me at the time Copyright © 2018 HubPages Inc. Other product and company names shown may be trademarks of their respective owners. HubPages ® is a registered Service Mark of HubPages, Inc. HubPages and Hubbers authors may earn revenue on this page based on affiliate relationships and advertisements with partners including Amazon, Google, and others. This website uses cookies As a user in the EEA, your approval is needed on a few things. To provide a better website experience, owlcation. Please choose which areas of our service you consent to our doing so. For more information on managing or withdrawing consents and how we handle data, visit our Privacy Policy at: Show Details Necessary HubPages Device ID This is used to identify particular browsers or devices when the access the service, and is used for security reasons. Login This is necessary to sign in to the HubPages Service. Akismet This is used to detect comment spam. HubPages Google Analytics This is used to provide data on traffic to our website, all personally identifyable data is anonymized. HubPages Traffic Pixel This is used to collect data on traffic to articles and other pages on our site. Unless you are signed in to a HubPages account, all personally identifiable information is anonymized. Amazon Web Services This is a cloud services platform that we used to host our service. Cloudflare This is a cloud CDN service that we use to efficiently deliver files required for our service to operate such as javascript, cascading style sheets, images, and videos. Google Hosted Libraries Javascript software libraries such as jQuery are loaded at endpoints on the googleapis. Features Google Custom Search This is feature allows you to search the site. Google Maps Some articles have Google Maps embedded in them. Google Charts This is used to display charts and graphs on articles and the author center. Google AdSense Host API This service allows you to sign up for or associate a Google AdSense account with HubPages, so that you can earn money from ads on your articles. No data is shared unless you engage with this feature. Google YouTube Some articles have YouTube videos embedded in them. Vimeo Some articles have Vimeo videos embedded in them. Paypal This is used for a registered author who enrolls in the HubPages Earnings program and requests to be paid via PayPal. No data is shared with Paypal unless you engage with this feature. Facebook Login You can use this to streamline signing up for, or signing in to your Hubpages account. No data is shared with Facebook unless you engage with this feature. Maven This supports the Maven widget and search functionality. Marketing Google AdSense This is an ad network. Google DoubleClick Google provides ad serving technology and runs an ad network. Index Exchange This is an ad network. Sovrn This is an ad network. Facebook Ads This is an ad network. Amazon Unified Ad Marketplace This is an ad network. AppNexus This is an ad network. Openx This is an ad network. Rubicon Project This is an ad network. TripleLift This is an ad network. Say Media We partner with Say Media to deliver ad campaigns on our sites. Remarketing Pixels We may use remarketing pixels from advertising networks such as Google AdWords, Bing Ads, and Facebook in order to advertise the HubPages Service to people that have visited our sites. Conversion Tracking Pixels We may use conversion tracking pixels from advertising networks such as Google AdWords, Bing Ads, and Facebook in order to identify when an advertisement has successfully resulted in the desired action, such as signing up for the HubPages Service or publishing an article on the HubPages Service. Statistics Author Google Analytics This is used to provide traffic data and reports to the authors of articles on the HubPages Service. Comscore ComScore is a media measurement and analytics company providing marketing data and analytics to enterprises, media and advertising agencies, and publishers. Non-consent will result in ComScore only processing obfuscated personal data. Amazon Tracking Pixel Some articles display amazon products as part of the Amazon Affiliate program, this pixel provides traffic statistics for those products.
